CShisMan2_210


Sequence

>CShisMan2_210 (5 EST) Length=634 ACCACNATAGCAGTATTTATTGAAATGCGAGANTGATTAATTAATAAAGAACGATACATGCATAGCAAAATTTATCCACC GGTGATTATCATCATTGTAATAAAAATAGTAGGAATACCAGCAGTTCCCAAAAAACCCTCACCAAATATCAGTGTTCATT TGGAGGCGTTAGGATAGTCGTTTATAATTGCGAATGGCAGTAACGTCAACCAACAGTCACAGTCGTTTTCATAGTATCAC CATCCACTTCACGAACGATTACAGTTGTGTTTTTGGGATCCTACTTGAGTTTGCGTTAACTTCGACTCGGAATTTTTTCA ACCACTGACTTGACATTTCTGCCGTCACTTGNTTTTTCATCGAATTCCTCGCCGAACTTGAACGTACAAGAAAGATTTTT GAAAGTTGACTCTGTTAACATAGTCATTTTATCCCCATCCATTGTGAAGGTTACAGTTGGGGTCACTGTGTTCCCAATCT GTCGAGTTGCCCATGAGACACCTAGCTTTGACATGACAGCATNCGAAGCCTGTGTGACTCGCTAAGTTTCCACNTTCCCC AGAAACNAAGACATTTGTTTCCACCAAGTTTGNTGCCTCTNAATACCCCTNGACCGACCCACCGATTTTTANCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_210: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39147514541T14374SMEST0035Schistosoma mansoni, adult worm, Gloria Franco
344919975975R95605SMNHADA017046SKSmAW
345050981317R95657SMNHADA020051SKSmAW
4071441119150H98265SMNHADA015021T3SmAW
4236091139710N25362EST000463S. mansoni cDNA


Date: 4:14:22 on Wed 22 Nov 117.