CShisMan2_211


Sequence

>CShisMan2_211 (6 EST) Length=717 AGATAGAGATATATATTTAAAAAAGAACTTTCGAAACTTTGTTTAAATTATGTATTAAATTGACAAACAAAGTAATTAAT TTAAAGTAACAAAATTAAACTNGAAATCTTCTTTTATATATTTAAGTTGGTCGTATCTATTTTCCACGAACACATGTGCA TTGTCATACAAGCCGAATCTGGATCCATGGTGGAGATTGTATCAATGTATTTGTCAATGAACATTCCCTCCTAGAAATGA ACACTGAACTTCAAAAGATCCAGTTAGTGAACAAATTTTATCAACAGCTTGATGTACAATTGCTTTTGCTTCTTCAGATT TACTGAACGTTTTCAAATATGCTACAGCCATTTCACATGTTGAACACAAAAAGCTAGAATTACCATATTGAGGTCTTTCT AATGTAGACTGACACCAATTCAACATTGTTTTCAAACGGTATGATTCGATGAATTCAATGAAATATTGTACAAGTATTCT TGCTTCAGTCGCCATTGAAGTTTTGCACTGAAGTCTTTTGTTTAAATCCTTCACATTGTCACATGTTATTGACACCAGAT ATTCAACCATATTTCCGATGAATTGTTCTTCTTTCATAATTTGTAAGCTTTTTTCTTGTGCCAATTCCAAAAGGTTACAT GCTACATCTTTATAACCAAATTCCAACTCAGGTTGATTAATTGAAGTAACAAAACCTGTTATACAAAAAATGGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_211: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345023981290R95630SMNHADA019046SKSmAW
345051981318R95658SMNHADA020058SKSmAW
5858761377937U58058SMU58058Schistosoma mansoni adult worm Lambda ZAP II library
15469432897564AA825086SMTBCEA000001SKSchistosoma Lambda Zap II cercariae
16629243080349AA931040SMTBADA000219SKSchistosoma Lambda Zap II
18151343385494AI067527EST209209Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:7:45 on Wed 22 Nov 117.