CShisMan2_213


Sequence

>CShisMan2_213 (3 EST) Length=542 GGGTACTCTATCTACGACGACACTCTATATATTTAGTATAAATCATGAGTTTTATTTGGGACTGGCTATCTGGTTCTGTG TCGAAGGTTCTCAGTTATCTCGGCTTATGGCAAAAAAACGGAAAGCTGGTATTTCTAGGTCTAGATAATGCTGGGAAGAC AACATTATTGCATCGTCTGAAAGATGATCGCATGGCTCAACATGTTCCAACACTTCATCCAACTTCTGAAGAATTGTCAA TCGGTGGAATGAGATTTACGACATTTGATCTTGGTGGGCACGAACAAGCAAGGCGCGTTTGGAAAAATTACATCCCAGCT GTTGATGGCCTTGTCTTTATGGGAGATGCATACGATCGTAACAGATTTTTGGAGTCAAAGAAGGAGTTGGACAATCTCCT GCAGGATGAGCAAATTGCCCACGCCCCTATTTTAATACTCGGGAACAAAATAGATAAGCCCGGTGCAGCTAGCGAGGAAG AATTGCGGTACTTCTTGGGGTTACAGGGGATTACAACGGGAAAAGGTACCATTAATAAAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_213: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350245988876H49035EST000178S. mansoni cDNA
8577831832543AA218450MAAD0105.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18151443385504AI067537EST209219Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:35:1 on Mon 20 Nov 117.