CShisMan2_2133


Sequence

>CShisMan2_2133 (2 EST) Length=202 AATGAAATCAGTGTATTTATTGAACTGACCATGTGATGACTTAATAGGGAGGTACAAAAATAAGGGAATAATTAATATCA CACTCACATCACTGATCGTTTTACAGCTTCTAAATCTGGACCACTTATCCATAAACAAACAGATGGTATTTTTACTATAC CATTATTTGTTTGCACTGTCCAAAAGTGTTGACCATCTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2133: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60710529740T24137SMEST0335Schistosoma mansoni, adult worm, Gloria Franco
5137771445030W06810SMEST0446Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:16:59 on Thu 23 Nov 117.