CShisMan2_2146


Sequence

>CShisMan2_2146 (3 EST) Length=251 ATTATGTGTAGAAACTGTGATATTCCTCATACACAAGAGCTCATTGACACCATCTCACTTGCTCTCGACAATACTTCATA ATGATTGGTAGATTAGTTAGTGGACAGCCATGAGAATACCTGTTCCGCTCCCAATACGACCTAAGAAGTCCGCCAATACT GAAAGAGCGNCCGATACATAGACCACCAAGTGCGGCTGCTGTTGGGATGTAACGATTCAACTCATGCACCATTGAATTCA TCCCGATATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2146: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364561644592AA098622SMTBADAMS0613SKS. mansoni cDNA
16890823116451AA952859SMTBADA000613SKSchistosoma Lambda Zap II
16891683116537AA952831SMTBCEA000413SKSchistosoma Lambda Zap II cercariae


Date: 20:43:37 on Tue 21 Nov 117.