CShisMan2_216


Sequence

>CShisMan2_216 (6 EST) Length=1213 ACGGTTTTTGCCCATATCGAATACTGTATAAAATTTACCTATGAATATATCTCCTAATATCCATAATTTCCTNTTCGGTA GGTCCAATCCCCATGAAACCGGTTAGGCAAATCTCAGAACCCATTTTAGATACCTTCAATAAATAATCTGTAGGTTCTAA TGTCATAGCTTTTCCGTTTANNACAAAATCAATNGTTGGGAGATTGTTTATATTCCCACAAGAAACGGTATAAATACCAC CGGGTAGACGAGTGGCTCCGAGCTTTGCATTGATTTTTTGTATTTNGTCTGTTGGACCGGCGATCATCGAAGTGCCAGTA TCAGCAATAGCTAGACATCCATCAGGACAAGCCGTCATATCTGAGATAGTCAGCTTGTCCATTTTGAACAACCAATAGGA CTGTTCCGTTAAGTCCACATAGTTGATTTCGCCGGAGTAATACTTTTTATCGATACCACCAATCATCAGTTCACCACCCA GCACAGCTGATATATTCCTGCATGAGATAAACAGGAGCCAACAATGGTAGAGTTCAACTATACCTTGCTGGATCATGTTT ACGAATACAGGAGTAACGCCATCCACGGAAATTGAGGGGTAGGCCATACCAAGGATACCATCGAACTTCGCCATGACGAA AACCAACCCTGGTTGTTGTGTCGCTTCCCCAAACGTTTGGCCCTTTACACTCAGTGAGCCCAACTGAAGGGAATCTGTAC TTAAGAACCCACTGAGACTGCCAGTACCGTAATGAACACTGAACTCAGTACCATTCGGGATGTAAGTGGAAGACTTTGAA CTGTCATACTTCCTGTGTAGTAGGCAAGCAATGTCAAAGTAGCTACAGTATTTTGACGGCACCCAAAGATTAGACGAACC AGTATCAAATACAACGCTGAATGTCTGAGGTGGCGTACCAATCGTTATATCACCGTAGTATTGAGCATCAAGGTAGTTTT TCAAGTATTCCGGTTGGGGATCAACTCCAGATACCCTGGATAACCAGACCTTCTTAACAATTTCTAGAGAAGTTTCAAAC TCAATAAGAGTGCGTTGAGCAGATTTTAACGGATGAAGAGGGATCCTAACCACTTCAGATGCAACAAGGTGTAGCAGAAG AACTAGAAGCAGCATCTTATCATTCAACTAAAACTCGTCGCACATTAAGACTCACAGTATTCATATATAAATTAAAACAA ATATTCAAAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_216: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9262901929517AA285198MA1AO003.ADOS. mansoni adult Lambda gt11
18153303385690AI067723EST209406Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154393385799AI067832EST209516Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155373385897AI067930EST209618Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156193385979AI068012EST209701Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694723509873AI110903MF003C07.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 2:5:54 on Wed 22 Nov 117.