CShisMan2_219


Sequence

>CShisMan2_219 (14 EST) Length=661 GGGGACAATCGAATGTATTTAAGCAAAGATTACAGACTATCTCAATAAATTCTGATTACCAAACAATGAACAGTCAATTT GCAAATTAACAACCAATTGTTTCAATCTTCACTGTTTCTTCTCTTATTCCATTGCTCATGCATTTTCCAGACGTTTGCGT TTCATTTCAGTTCTTTCCTCATCGGTCTTCTGCCAAAATACATTCTATGTCTGACCCACACCATATACTACTTATATGGA TATAAGTAGACCACACCACACTCGTCCCCCCTTTAAAGCATTCGTTCATGCGGTGGTTCTGCTCGCCATGCCACTATCTT CTTTCACTGCAGTCTGTGCCAAACTCTCCGTCAGAATGTCGAGTCTGCGGCGCGCTGACCTCCATAGCTCCGTCGACCTG CCGGGGCACCAACATCCGCATCCACCCGGCACCTGGGACGTTCAACACCCGTACTCCACCGGCCTGCTGAGCCATCTACA TCCGATGTCCGCCCAGCAGCCGCACGTCCCACTGCTCCTCTCCGTCGACAGCACCCGCTACAGCCAANGCCGCCCCGCCA GAACACTCCACTNGACGCCAACTNTCCACACCAGACTGCCCCAACTAGCACCTCAACTCCAGACCCGCAGCGGCGTCCGC AGNACAGCACCCTTCCTCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_219: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39179514573T14406SMEST0067Schistosoma mansoni, adult worm, Gloria Franco
39375514769T14602SMEST0263Schistosoma mansoni, adult worm, Gloria Franco
39417514811T14644SMEST0305Schistosoma mansoni, adult worm, Gloria Franco
344893975949R95579SMNHADA008085SKSmAW
16715943096898AA938787SMTBADA000477SKSchistosoma Lambda Zap II
17580843233263AI018927SMEST0567Schistosoma mansoni, adult worm, Gloria Franco
18146723385032AI067065EST208735Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150493385409AI067442EST209124Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150903385450AI067483EST209165Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155113385871AI067904EST209592Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157463386106AI068139EST209829Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157673386127AI068160EST209851Schistosoma mansoni, Phil LoVerde/Joe Merrick
18695503509951AI110981MF002D11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696063510007AI111037MF001G11.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 2:28:23 on Thu 23 Nov 117.