CShisMan2_22


Sequence

>CShisMan2_22 (4 EST) Length=671 GTTGGAACCCTACGATAACCTGTGTCGATTATCTAATTATCCTAACAACACACTTGTTATTATTGATTGTGGTCACTCGC TTTCATTCCTAGATGTAAGTGCACTCTCTATGGTTACTGAGTCGACTTATAATCTGTTTGATAAAAAACGAAAAATGGAT GAGATTTTCGAACATTTCCATAAAGTGTTTGAAGATATGACCTTTTCAGGGTTCTTTACTCCAAAGTTCAGAAATCAGTC ACCACGTGATGAAATGCTACGCCGACCGGAGAATGAATCAAATTATTCTCAAGTGCCGGAGCCGTGGATGCCTTTTCCAT TTCATGGCGACTTGGTCAAACCAGATATGATGGATAGAGAAATGTTCAATGAGACTTTGAGGCAAATAGATCCTCCTGGT TTTAAAAAAGGAGACATTATCATTGATGGTCAACCAGCTAATGCCCCGTATGCTGAGAAGCGTGACTCATCAGTACGTAG ATGGGTCAGTTCTTTCACCAGCAAAACGCTTCATAGTGAATAACAGTGAAGTGAAAGAGTTACAGAAAAGAGTGGTTCGT GAACCAGATGACACTGAAGTTCATACCACGATCGAACGGTCATCTGATGGGGAAAAGGAACATGTTGTCTATATGAGACC CGATGATCAGCAGTCCCAAGCTGAGGATAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_22: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147073385067AI067100EST208770Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152863385646AI067679EST209362Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154993385859AI067892EST209579Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155623385922AI067955EST209644Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:50:29 on Sat 18 Nov 117.