CShisMan2_2205


Sequence

>CShisMan2_2205 (2 EST) Length=189 TCCTTATCATATCACCATTCATTTCAATCTTATCTCATTGAATCAATATGAAATTATCATTAAATGAACAAGGATGGAAT AGACTATTCATCATATTAAATGGTACATTCTTGGTATATAGTCTAGTTTTATGTGGATTAAGTATTAAAAGTACAAGATG ATCTATCTCAATTCAAATGAAATTTTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2205: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364581644594AA098624SMTBADAMS0615SKS. mansoni cDNA
16890843116453AA952861SMTBADA000615SKSchistosoma Lambda Zap II


Date: 0:38:53 on Fri 24 Nov 117.