CShisMan2_222


Sequence

>CShisMan2_222 (12 EST) Length=542 GTTGTCTAGGAATTCTTTAGTTATTGTATTAAATTGTCTTGGGTCTCCATTTATACGAACAGCAACCTCTGAGTGCCCAT AATCTACTCTCCATATGCGAGGCCATTCAGGCCATGGATTTTCATTAATATCACGAGTAGTTGGTGGCGGTGGGAGAATC TCAAACACACGAATATTTTCGGCTCCATGGCGTACAGATGTAGCAATACAATCAACACCTGTGTCACCCCCACCAAGTAT AACTACACGTTTACCTTTGGCTAATGTAGCCACAGAATCAGAATCAAAATTATTATCGTTTTGAAGATCAAAATATGTGT GCTTAATCCTATTCTTGTGTTGATAACGTTGCCAGCGTTCAAGGAAACTCATAGCAAAATGAATACCTTGAAGTTGACGA CCTGGAATATTCAAATCGCGAGGCCAAGTAGCACCCAAACATAAAACTATTGCATCAAATTCATCCAGTAGTTTTCTAGC TGACCAAATGTTTTCTTTATCTGCTGGATCGCGACAAACAGAATTTAAATCTCTGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_222: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146873385047AI067080EST208750Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148333385193AI067226EST208900Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150423385402AI067435EST209117Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152133385573AI067606EST209288Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154153385775AI067808EST209492Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154573385817AI067850EST209534Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156213385981AI068014EST209703Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156683386028AI068061EST209750Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156693386029AI068062EST209751Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159143386274AI068307EST209998Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159193386279AI068312EST210003Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159303386290AI068323EST210014Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:14:12 on Wed 22 Nov 117.