CShisMan2_2250


Sequence

>CShisMan2_2250 (2 EST) Length=186 AATATTGAAAAAAGTGAATATTTACTCTTTTATTCATACAAATCAAAGTCAATACGTGTGATATTATAGAATTGTCCATC AGATTTCGTTGATTCACGTATTAAAATATTGTCATTGTCATTGAATGTCCCATCTTGAAGCCACGCCTTCAATTGTCCAG ATGTATATGGTCCTTCAATCTCTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2250: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39351514745T14578SMEST0239Schistosoma mansoni, adult worm, Gloria Franco
39414514808T14641SMEST0302Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:59:2 on Wed 22 Nov 117.