CShisMan2_2254


Sequence

>CShisMan2_2254 (2 EST) Length=184 GACAAGTTATGCATCACTGAAGTGACTAATTATTTACACTCATTACACATTAGTTCTTGATGATCATCACCGCTGCATTA TAGAAGATGCCTATGGAACAAATGGTAGCCAGGAGAATATAGGTTTTTATTATGTATGTATATATATATGCATATTTCTG TATTTATCTCTATTAATCAAGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2254: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350227988858H49017EST000069S. mansoni cDNA
4236421139743N25395EST000071S. mansoni cDNA


Date: 17:59:45 on Mon 20 Nov 117.