CShisMan2_226


Sequence

>CShisMan2_226 (2 EST) Length=664 GGAAAACCGTAGTGTATTCGACTCACTAGGATGTTGGTTGGGAACTCTTACGTATATTCCCGAAAGAATTGTTAAAACGA ATTCCATCAAAAATATTAGAGAAATACTATCCTCGTTAATTGATTAGTTGATTTTTAACCCTATTATCCTGGATTGTGAA TATTCCTACTATGAAAGTTGCATTATTTATTGGTTGAAGTAAACTCGGATATTGTCGTCAGCTTTTACATTCCTATTTAT TTTCTGCCCTAACCATTATCATTTATAATTTTCATTACTTCTAATGGTGACATTATTCAGTCATCACAAATTACTTACTC ATGATCATTATGATTTTTGATTTTGTTTCAATGTTCATTCCATTTACAAAGCTCCCGCATGATAGTTTTCTATTACACTG TATTTTCTTTGTTCTTTGATGTTTCAACCACTTCACTTCACTTCCTGAATGGTTCCTTTACCCCATTACTACATACATTA AATCTTTCCAGTGTTTTGGCAATTTTTGGAAAATAAACTATAAGCATAATATAAACATACTAGTGGTTAAGGTTTCATTT CAATATAAAGCTATAGGCTTCTGTTTTTTTCTTCTTTCATTTGATTTTGTGTGCAGAACTTCTAATTATTACCAATATTG AACAATTATAATAATAATAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_226: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137451444998W06778SMEST0414Schistosoma mansoni, adult worm, Gloria Franco
18694573509858AI110888MF003D11.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 13:57:26 on Mon 20 Nov 117.