CShisMan2_2268


Sequence

>CShisMan2_2268 (2 EST) Length=181 ACAGTATAAAGGAACATTATTGTGGACAGACGCTACAAAGACAGTTTATTACTCTATCAATCCTGATCGCCGAATACGTG TCCGTTATGTCTGTTGTTCTAATCGTTTCCAAGCCTTATCAGACAGGTGATTGTCCACAAGCTTCAACTAATCCATGTAC TTATTCTAATGGACGATTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2268: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644391017366H63020EST000188S. mansoni cDNA
16629253080350AA931041SMTBADA000188SKSchistosoma Lambda Zap II


Date: 22:4:7 on Sat 18 Nov 117.