CShisMan2_228


Sequence

>CShisMan2_228 (2 EST) Length=797 TTGGACCGGCTCTNGCGCTTTGTGGAAAGACATCGTTGGGCAAAATTTTGATACAAACCAATCCAGTCACATCTGAACCT GAATTACACTACATTCGTTTACCTCGAGTTTTTTTTTTTTTTTTTAAAGATGTCAAAAAATGTATTTAAATATAAAGAAA GTTTAAAATTCTTGCTTACAAGCTCATTTTTAATAACACATTATTCAAAAGGTTTACATTTAGAGTATAATCAAAGCATC TCGTGATATTCTTCTTAATCAAAACTCAACATGGTTTGAACAGAAACCAGAAGATGGGTGTCCTCTTTAATAATAGTACC CATCGTTCGTATTCCTTGTATGGTAAATCTGAACCCTTGGGTATGTACGCGGAGAATATGAAAGTGTATTGCCATTATTG GAAATCGTGTCGGGATCTATCAGACGATTGTTAGATATCGAACGACGAAGTGGATACGGCGAATAGGTGCTTGGAACGTA CGCATCCCCAACAGATGCGCGATATGATGGATAAACGGGCTGATAAGAAACGGGCTGAGCATAACTATGACGCTGATAAC TATTTGGCATAGGCCCCGGATAAAGTGTTTCTGTAGGCTGGTAAACTGAAGGCGGACGAACGTAGTAGGACTCACGAGGC CTAGCATAATATGTTTNTACAGGTTGATATACAGAGGGCGGACGTGAGTAGAAGTNGTCATAATTTGGTTGATAGGGCCT TGAGTGTCTTGATCCCCGATAATTATAGCGATAGTNGTCCCTAATCCGATCATCCAAAGTTTTAGGATGTAAATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_228: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099892330278AA559582MC080508.NA3TBRI-Saber-cercaria-A
17369743189894AA999339MCCE3163.M1FSchistosoma mansoni, cercariae


Date: 2:26:0 on Thu 23 Nov 117.