CShisMan2_23


Sequence

>CShisMan2_23 (7 EST) Length=676 ATTTGTGTAACAATCATTTTGAGAAAGCTCACTGTCATCGATACGTAAAGTTAAAAAGAATCTAGCCCTCTCGTGAATTT GTACGTCGAAAATTCCGCTAGCAAAGTCGAGCTCGAAATATGGGGAATCTTCAGTAGGATCGTTTGTTTGAATAGGTTCA TCAGTACCAACTTGACTGTCCTCACTAATGTTCATTTCGCTCACTGGAATTTTATCATTGTTTGTGGAACACCTAGTCTT GTTTTCCTCGTTAGTTTGATATTGCCTAGTATTGTAACCACTACTGTATGAGTCTCGTATTTTATTATTTGGACGAACTG GCTCTTTCCTAGATGAATTATATAATTGTGTGTAATGAGCATTAGAATAATTCTTTTGAGGTTGTTTATGATGAGGTGGA TGATAACGATTATTGGGATGATTGTAGTAATGATGATGTGGTCGGTGTTGATGTTGATAATGATGATTTAGAGAGCGTGG TTGTTTATCCATATTGATTTCTAGTTTGTATTTTGCAATATCCTCTGGGGTTAAATCATCAATATATTCATCACCAGAAT GGTGACGACTTTTAAAATCTCCATTGTGAAAAGAATTTTGAACACGAATCCCTGGAGTATTCTCATGAATTCCAAATCTA TCATCATGACCCCAGTATTGTCTTGAACCCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_23: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146433385003AI067036EST208705Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149773385337AI067370EST209049Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153473385707AI067740EST209423Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154583385818AI067851EST209535Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155693385929AI067962EST209651Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156153385975AI068008EST209697Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159543386314AI068347EST210038Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:0:19 on Wed 22 Nov 117.