CShisMan2_231


Sequence

>CShisMan2_231 (2 EST) Length=531 GCATAATCGTGAATGTTGCTACTGAGTGAGGCCTTGCAGGCACTAATTATCCCCAGCTTCAGAGACTATATACCCAATAT TCTGAAAATGGCTTCCGAATTTTAGCTTTTCCTTGTAATCAGTTTAGAGGACAGGAACCCGGAACTGATCAAGAAATAAA ACAGCGCGTGTTAGCAAAGTATAATGTAACATTCGATTTGTTCCACAAAATTGATGTTAATGGTGAAAATGCTATTCCGT TGTACAAGTTTCTGAAACAGTCAATATCGTCTTGGTTTTCCAGANATATTGAATGGAATTTTGTGAAATTTCTAGTTGAC AGAAACGGTACTCCTGTATCTCGTTACAGTTCGATAACTCCCCCCAATAGTATGGAAAGCTGAAATTCGAAAGTTACTTG GTCTTTCTAATGAATTATAAAACTTGATTTAATTACCTGTTTGTCTGTTTGCTTTCCTTTTGTTTTTAACGATCTTTCAT CCAAAAGTTAATATGATCAGTGATATACACCATAATGATAATCCGTGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_231: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694513509852AI111164MF003E05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696123510013AI111043MF001G03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 7:32:49 on Sat 18 Nov 117.