CShisMan2_2318


Sequence

>CShisMan2_2318 (4 EST) Length=175 CAATTGTTTGGTTAGTATGGTGCACAAATATCTATATCGATATATACATACATACTACTGTTTTTTGTCTTCATGTTTAA GTTTCAGATATTGGAAGTTGAACAGTTATGTTTATTACCTTTAAACTCAAAATAGTATGATAAACAGTAAATGTTAAATT ATTTTTAAATACTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2318: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644411017368H63022EST000210S. mansoni cDNA
3644421017369H63023EST000211S. mansoni cDNA
16629193080344AA931035SMTBADA000210SKSchistosoma Lambda Zap II
16629203080345AA931036SMTBADA000211SKSchistosoma Lambda Zap II


Date: 1:42:28 on Sun 19 Nov 117.