CShisMan2_232


Sequence

>CShisMan2_232 (2 EST) Length=286 GCTGCAGGAAGTCGGCACGAGAAGGAGCTGGTTGATGAAGAAAGATGGTTTCGTAAATCTCAACTTGAAAAGGGCGACTT TCGTGGTTGGTATTTTATCCCAGTTAATCCAACTGGCGTGAATAGCTCATTTGAAAGACTCACAAAAGATCAAGAGGCTG GTCAACTAGTTAGTCGTTGATTATAAAACTCATTTGAGAATAATACTTTGTATTATCTTTCATCTAAGTGCAGTTTATTT TAATCCTAAATCANATGTTATGAAAAACTTCTGTTATTCNNTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_232: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190091126896N21726SMNHADA00E031SKSmAW
4292001145926N28070EST000031S. mansoni cDNA


Date: 11:59:31 on Wed 22 Nov 117.