CShisMan2_236


Sequence

>CShisMan2_236 (5 EST) Length=526 CTTCTTCAATTAGGCTGTTCGCTTTTTCTATATTCTTTGTGATCAAATCCCTATCTCCAAAAAAGAATCCAATTCGTATG ATATGGAAAATTGTGTCTAATCGAAAGCCTGGCATTAAGCTTTTATCCAGAATCAGTCGAAATTGGGACAGAGAACCTTC CTTGTCACCAATCTTACTAAGATAGTGAGCTTTTTCCATCATGGCGGTTCTGATTTCTGTATCACCTAGATTCTCTTCCG CATCTTTAATCTTTGCATCTAACTCCTTAATTTTTGCTTCATTTACTGACTGCATAGATTTCAAGATTCGTTGGTCAACT GGTAGATTAAGCTCTTTACACACAAGTTCGTAGTATGGAGCCATATTATCATCTTGGATACACTTGGTAATTTTCTCCAG AAGCTGCTTACGCAAAGGTTCAGGTGTTTTCTCTAATCCAGCACGAAAGGCCCATTGTGCTAGCTTAAGGTTAGGAATCT TTTCAAGACCCTCATCTTCTAGGCGTTCCAGGGGCATTTTACCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_236: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148073385167AI067200EST208874Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153933385753AI067786EST209470Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156463386006AI068039EST209728Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157833386143AI068176EST209867Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158963386256AI068289EST209980Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:11:27 on Wed 22 Nov 117.