CShisMan2_237


Sequence

>CShisMan2_237 (4 EST) Length=519 CACTTTGCAGCTTGAAAAAAGTCTAAACCTAGATCATGGAAGAAAAAGGTGATCAAGTTCTGTTGAGTCATGATAATCTC GATAGAGCTTCACCTGATTTATGGCCANAACAAAGTAATTGTCTTATTTATACTTTTATTTAGTTCCTGGTGTCACTGAA TTCCTTACATCCCGGCAAAACNAAATAAACTTACATACCCCTCCGAAATATGCTACTGATTTGGATAAAGAGGATCTGGA ACTTATTCATGATTTTGGGAGTCTGTCAACTCAACAGCTAATGGATAAAATTAAACATCTACAGAATTTAGCTTATCAAG TTGGATTGGAAGAAGCAAAAGAAATGACCCGTGGGAAATTTTTAAATATTCTTGGGAAACGCTAATTTCTGGGTTCTAAA ACTGAATATAACTATGTTCCACTCGTTTTCGTTTAAATGGTTTATTAAACCAACGTTATTTATATTATGGTGGCATTTTT TGCTGTTATAATTCCCACATATATATATATATATAAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_237: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694253509826AI111138MF003G07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694273509828AI111140MF003G05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694283509829AI111141MF003G04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695263509927AI110957MF002F12.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 18:4:53 on Fri 17 Nov 117.