CShisMan2_2376


Sequence

>CShisMan2_2376 (2 EST) Length=207 GAATGATGGTGTTTCAGTGTTACTTACTCAAGTTTCACATACAGTCAATTGATATATTTCGATCAATCTTTTTTTATATA AGCAGCAATATCAAATTTCATATTTCTGTCAAGTGCAGCAGCAGCTGTATGGTACAGCGGTCTCTTGCATATCTTCATGC ATATCAGCATTCTTAATAACAACTTTGCGGTTGTCCCCCTTAATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2376: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233762870778AA801606SMTBADA000757SKSchistosoma Lambda Zap II
16629163080341AA931032SMTBADA000203KSchistosoma Lambda Zap II


Date: 12:13:34 on Mon 20 Nov 117.