CShisMan2_238


Sequence

>CShisMan2_238 (2 EST) Length=525 GAAGAGAAACACAAGACATATTTATTAAACATAACGAATAATAATTACCAATAATATATACCATGTAAAAGTATCAAAGG AAATAAAAAATAAAAATAAAGAATATTACCTTTCTTAATAGAATTTGGGTCAAATTAATGTATGGTTGATTAAGTATACG TAATTAATGAAAAATAATGATCAAGTTTCTTGATAGTTAAAAACCAAAAGGAGATTATTCACATATTTTTTTTTGGAAAT AACTGTATATGCTAACTGTGTAGAATGCAAGTGGACATTTATATAATAGTTTAACAACAGTCTCCATAAAGTTTTGGTTC ATTACTATCAAATTGTATTGATCTACTTGCTAAAGAAGCAGCTAATGCAGCATTATGACCTTGTTTAACACCATCCCAAA TACCACCTGCGCATAACTCATTGTAACTTCCTTTAATAACATTGGGGGTAAATGCCCTCAGCTAGCAGTTCGAAAGTTTT CTCAATATTTTGGGTAGTAAGTGAAGATGTCCCAATATAGGTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_238: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368883189808AA999253MCCE3048.M1FSchistosoma mansoni, cercariae
17371303190050AA999495MCCE3394.M1FSchistosoma mansoni, cercariae


Date: 9:53:34 on Fri 24 Nov 117.