CShisMan2_239


Sequence

>CShisMan2_239 (6 EST) Length=525 GTGAAAATCAGTAACAGGATAAAATAAACCCATATGAATAAACACTGTACTGGCTGAGCAAGTTGGTGGCGCCTTGACTA CTCTGTAAAGGATAACTTGCCAATGTTTGAAAAGATTTGGACTAGGTTTGAGTATAAGTGTGAATACCAATATTGAGATG AAGCTGTATTAAGCTGAGAAATGCTAAACAGGACAGAATGTACATCGTTGATTTAAGAGCTAGCTAGTATCCAAACATAC TAGTAACGTTTCAGTTAACTATACGTTATCTTTTTGTAATAATATTCTGGCTATTGACGAAATAAGAAATCGTTTCTTCA TTTCATGTGTATTTCTACCTTAATAAGATATCTAAAAAAAAACGTAGTACTTTGAAAACAGTTTACCGTCAGAAATGTTA TCATTAGAAAATGCTTAATTTCTTCGATGAGTAATTCATTCGCANAATTACTCAACGATATAAATTTGTCTGGATGTACA TTTGACCATAGNAACATCTGACTTAATAAATACTATAAAACAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_239: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146443385004AI067037EST208706Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149273385287AI067320EST208998Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149373385297AI067330EST209008Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150623385422AI067455EST209137Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153033385663AI067696EST209379Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158983386258AI068291EST209982Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:20:49 on Fri 24 Nov 117.