CShisMan2_24


Sequence

>CShisMan2_24 (6 EST) Length=672 CTTTGTTCATTCGATATATACATAGGTGTTGCCCAATTTCGTTTATCTAATTCTATATTATTGACTTTATGATTCGAATG ATTATTTTTTAAGGCATCAATCAGTCGATCTGTTCCATGTACATCATTGGATAAATTCACATATGTATGTCGTCTAACAG AATTTTGTGAAGTTTTCTTCGGTTGAGGACTACACAGACCCAATGAATGATTTGGATCATCAACAATTGTCATTTGTTTT TGAAAATCATTGGAATTGATTGAACTAATTTGCTTCAATGAATGACAAGTATATAAAGGATTATTCATACTACTAATATC AGTAGTACTAGTAGTAGACAAAGATGTTATGATCTCATTATCCGATGTAGAGATAATAATCGGATCAACTATAACTGATT CTTGTTCTATAGATGGATAATTTAAAATATTTCCATGACTTGAAATAGTAAAATAACCAGATGATGAAGAATTCCCTAAA TAAATTGGATTAAACTCTGAATGTTCAATTGGTTCTGGATTCATAATATCACTACATATATCAATTGATGCACTATGATT AGATAGGTGTTGATGATCTATTCCTGATGACTTTTGTAATGTATTACTAACATGTATATTATTGTCAGTATCTACAATGT TCTGATGAATAATAATAGGTTCTTGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_24: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146113384971AI067004EST208670Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147053385065AI067098EST208768Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150633385423AI067456EST209138Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155883385948AI067981EST209670Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158263386186AI068219EST209910Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158613386221AI068254EST209945Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:7:58 on Sat 18 Nov 117.