CShisMan2_2421


Sequence

>CShisMan2_2421 (2 EST) Length=165 GTTCTAAAGTAATATATAGTGATGTAACAATAATTACCAACAACAACAAGAAATATTTGTAAATCGATTTCAAAATAAAA ATGCAATAAGAATATTTCAAAAAAATAGGAAAAAAAAAAAAGATTAGGAATTACATGAGTGAAATACATGANTAGACAGG AGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2421: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344820974677L47080SCMRAP167C2/25RY adult worm mini-library
344825974682L47085SCMRAP172C2/25RY adult worm mini-library


Date: 6:44:0 on Sat 25 Nov 117.