CShisMan2_243


Sequence

>CShisMan2_243 (4 EST) Length=668 AAACAAACAAACAAACGNACCAACTTAAATAAACNAACCACAATAACAAATGNAGNTTAATGAAATAAGAATGGACGGAT AAAAAAAATATTCATTATTTGCATGTACGTACGGATGTATTATATCTATTTTATGGAATTGTTTTTTTTTTTATCAAAAT ATTCAAGGAAGTAAAGTTCATACGAAGTTTCTTTAGTGTAATACTGATAACAATAATAGTGATAAATAGTAATAAGAAAG GTAAAAAAAAAAAGGTGACGTAAGCGAAAAACNAAACAATTAAACAAAAAACCAGATTAGTCATGCATAGTAACTAAATA TTTTTTTAACCAATTAAAATATTCAACATTGAAAATTAAGAAAGAAAAAAAAAATGAGAAAACTGATTTAATAAGAATAA CATTTTGTAATGAATATGATCCAGTTAATTATGAAATAATGTTAATATTCAATACGTTCATTCTAGTCAATATTCTCTTT TGTTTTTTTTTATAAATTTGTACGAACAAGTGCTAATAACAAACTACGATAATCTCCACTGGTATCACCTTCAATCCAAG ATTCTAAAGAATCACCAGCTAGATCGTAAAATTCTCTCTTAATCAAATGTAAATCAATTTCACAACGTGACACTATAATA CGAATTAAATCTCTGTCATTAGTTCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_243: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291631145889N28033EST000113S. mansoni cDNA
11587162252893AA514128MA2MA101.AA3S. mansoni adult Lambda Zap
11587262252903AA514099MA2MA111.AA3S. mansoni adult Lambda Zap
18693983509799AI111111MF004B01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 16:7:9 on Sat 18 Nov 117.