CShisMan2_244


Sequence

>CShisMan2_244 (3 EST) Length=804 ATTCCGGCANCGAGCCCTCCAAAAGCCTAAGGGGTAAATAGGGCCCGTTCCTCAAAAGCCTAGTTCAATAGCACCCGTTN ATTAACTAACTCGTCCCATCCATAATGGTTCTCGGGCCCTTAATTTCCGCCAGGTGAAAGCCGAAATTGGGACCCCCAAA GTTTACCTGACCAAAAGGTGGTTTTTCCGAATAATTGAAGGTTGATTGGAAAACCCACCTTGGTCGAATTAAATTATCGG ATTGTTTGGTAAAACAGTGCCTAAGACAGTGGAAAATTTCATACAACTTTCAATTGGCACTCAACTGAAGGATGGTCGAA CTGCTTCATATAAAGGAAGCACTTTTCATCGTGTTATTAAGTCATTCATGATACAAGGTGGAGACTTCACAAACCACGAT GGAACTGGAGGTTTTAGTATTTATGGCGATAGGTTCCCTGATGAAAACTTCAAATTGAGACATGTGGGTGCAGGGTGGCT GTCAATGGCTAATGCTGGTCAGTTGATACAAATAGAACGGCCAATGTCTTTATTACGACCGTGAAGACCTCGTGGTTAGA TGGAAAGCATGTTGTTTTCGGAAAAGTTGTAGAAGGAATGAACATTGTTAGACAGATTGAAAGTGAAACGACGGATTCAA GAGATAGACCTGTTAAGAGCATCAAGATAGCCAGTTGCGGCCACATTCCCGTGGAAATACCCTTCTCGGTAACGAACTCT GATGCTGTCGAATGAACTAGTATGAAGAATTTCTTATACTCTTTTGTATTTATGTACATTCGTGAATATAATTTAGTATG ATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_244: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641411685457AA125705MLLG0122.M1FSchistosoma mansoni, lung stage
17372133190133AA999578MCCE3526.M1FSchistosoma mansoni, cercariae
18151363385496AI067529EST209211Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:52:8 on Mon 20 Nov 117.