CShisMan2_2466


Sequence

>CShisMan2_2466 (2 EST) Length=160 AACTCTTATATTCATTGTCTTTCATAGTTTATATAGAACAAATATACATAGGTAAACGCATTCAGTTTTAGTTTGTTGGT TTTGTTTATATCATTCTATACCTTTCTAACAATCAAGAGATAATGATATTTCAGCTACTTTTTGTTCCGTATTCTTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2466: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364591644595AA098625SMTBADAMS0616SKS. mansoni cDNA
16890853116454AA952862SMTBADA000616SKSchistosoma Lambda Zap II


Date: 5:10:19 on Sat 18 Nov 117.