CShisMan2_247


Sequence

>CShisMan2_247 (6 EST) Length=518 GCACGAGAATAAATATGACTACTAAATAGTGCATCATAGTGTTAAGTGATTGAAGGTATTCGGTAGAAAACAATGCTGAA CCTGTAAAATAGGACGATACTGATGCTGCCTGTGAGACTAAGACCCACATTACCCAGTTTTACGATATGAAACGTGACCA TTGAGCTACTCTGGCCGCAACTGACCAGTAAAAATAGATTATTTACATGGGGTTGGTTACCGAGTAGTGACCAATCAGTT GTAGTGCAGTACAGTAGTAGTTAATTTGTAGAAAAAGCAGACAATACGATTAGAATGGAACAAATCAATGCGGTCCAACG TGAAATATACTTAGTTACAAGTAAGTAATTGTAGTTTATAACAATATCAACCTTCTTATCAGCAGTAATCAAAACCTACA AAAACTTTGTAGCAAATACAAAAGTTTATTTCGTAGAGTTTATCAGTATGGGGTTGTTAGTCAGTCAGTCAGCTACAACG TATAACAGGCACATATATGCATCGGTCCAAGTTGCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_247: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146273384987AI067020EST208689Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146983385058AI067091EST208761Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149873385347AI067380EST209061Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150173385377AI067410EST209092Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151003385460AI067493EST209175Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157083386068AI068101EST209791Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 10:10:57 on Wed 22 Nov 117.