CShisMan2_2474


Sequence

>CShisMan2_2474 (2 EST) Length=159 TATCAACTTTCACAACATCTGNTAACTATGTTGGATCAGGTCATTCGTTATGTTGAAAATGTTATCGATAACAAATGTCC AGCTGACCCCAAAATTGGGAGGTCCATAGCACAGTTANTTTTCTCAATCCCCAAATTAGACCCTGATCATTTGGAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_2474: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344475972876L47008SCMRAP0953303/TCZ2 adult worm mini-library
344779974635L47038SCMRAP1253303/TCZ2 adult worm mini-library


Date: 21:23:47 on Fri 24 Nov 117.