CShisMan2_248


Sequence

>CShisMan2_248 (2 EST) Length=564 GCATTCTTCACTTACTTCGATCGAGATGATGTATCATTTCCGAAAGCAGCTGAATTCTTTCGAAAAGCTTCACATGAGGA ACGTGAACATGCAGAGAAGTTGGCGAAATATCAGAACAAACGTGGTGGTCGTGTTCAATACAGTGATATCAAGTGTCCGA CTAAGACAGAATTCAGTAGTTTGGAAGATGCTATGAATACTGCCCTTGGAATGGAAAAAGCAGTCAGTAAATCATTATTA GAACTTCATGAAGTAGCTTCAAAGAACAATGATCCAGCATTGGCAGATTTTATTGAAAGTGAATTTCTTCATGAACAAGA AGATGCAATCAAACAATTCGCCCGATTATTTAAGCCGAGACACAACGAGTCGGTAAAGGACTTGGAGAATATCTATTCGA TAAATTAACATTAAATGAACTAGAGAAGAATTCTAATTACCTATTATAAACTGACACTACATAATTATCATGATTTCATT TGATACCAGGATAGTTTTCCGTTTTCAGAAAATAATTAATTTGCCAAATATATCAAATAGCTAGCCTTAAGGCCAATATA TACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_248: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578151832575AA218482MAAD0147.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
16891553116524AA952818SMTBCEA000203SKSchistosoma Lambda Zap II cercariae


Date: 2:41:8 on Mon 20 Nov 117.