CShisMan2_249


Sequence

>CShisMan2_249 (3 EST) Length=522 TCTCTGTACAATAGCATCTTGCTTGACCCAGCCCGTTCAGTCCCGAACACAAATTATATCCTCCGCCAGATGAGTAGTAT ACTTCAGACATACGTGGTTTACATACACACAGACGAAACTGCATCAGTCCATAAAATGAAAAATAACAATTATACAAGAT TAAGCTAAAAGTGGCTGTGAGTATAAGAGACTGTAACCAAAAGATTGGGAATAAATCTACAATGACAAATAGTATAACAG TAACCAATATATCAAATGAAAGCTTATGGTGAAAGAAATATGAATTATCCAATAAGAATATATATAGTAATAGTACAGAA ATAATTCTCAGCAGTTAACATTCATTTATTCTTCTTTCGGGTATAACAACGAACATCACTTTGAAATGCTTAACAATACT AATTTTCTTTTAAAATATACTGTAAATTTATTCAAAAAAATAAGTCCTATCCAACATTATCTAGGATGTTGAGCTGACGA TGAAGACAGTTGCATCAATATATTGCTATACAAAGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_249: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150193385379AI067412EST209094Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150203385380AI067413EST209095Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156833386043AI068076EST209765Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:58:48 on Wed 22 Nov 117.