CShisMan2_2493


Sequence

>CShisMan2_2493 (2 EST) Length=157 GTGATGANTGCCGGANTGTGGATTGTGGGANGCTAANGGTTGGATGTGCCGAAACCACATATTTCAATCAAGGCACCGAA ATTCGGGTTCGGTCTGGGCAAGAAGAAGACGAAAGTGAAGACTCCAAAGGCTTGATGTGAAAGTTGGAGGGTTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2493: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826282160085L81222SCMRAP0321ENR2/ENR2 three hour schistosomula worm
11826342160091L81228SCMRAP0328ENR2/ENR2 three hour schistosomula worm


Date: 13:42:25 on Thu 23 Nov 117.