CShisMan2_2499


Sequence

>CShisMan2_2499 (2 EST) Length=167 GTTCACTTGACTCGTCACATCCATTAGTTATTGATATTTGCAATGATATTGATTGTATTATTTGTCAAGAGTAGGATTTA GAATGCATTATATTAAACTCATCAGCTTAGTACTTTAATTAACNCTGGATGGATGNATCCTGGATAGCCTGACCTTGATC AGTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2499: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103041907422AA269301MS1MM015.AS7S. mansoni sporocyst Lambda gt11
9103191907437AA269316MS1MM005.AS7S. mansoni sporocyst Lambda gt11


Date: 2:28:2 on Wed 22 Nov 117.