CShisMan2_25


Sequence

>CShisMan2_25 (10 EST) Length=667 TAAAATAGTTGAACTTGTTAAGTAAGGAATAATTGGTGTTGCATATGGCGAACCAGTTGGATAAACACTAGCTACTGGTC CTTGAATATCATGATATGAAAGATTTGGACAACTAGCTGATTGTGGATCTGTAGCAATAACATTTAAAATTAAATGAACA GCAGAGCGTGTTTGATCTAGCTCACCGGCAACAACAATGCATCGTTCTAAGAGATTGAATTCACGAGATTTTTGTGAAAT TTGCACATATGCACCGGTTTTCTCTTTGATCTCTTAAATATACGATCCACCTTTTCCTATAACCATACCAGCTGTACTAT TCGGTACAAGAATTTTCACCAGGATAGAATTCATCTTGTTTTGATATCTTGACCTTTGTATTAGTATCTTTCTGAATTCG GCCGATGGCCTCGCCAGACTTCCCAATAACTGCTCCAGCAGCAATTGATGGAACCAATATTTTCAGCTGGACGTTATCCT CACAGTTTGGACGTTTTGGACTTGTATCTGGGTCCATATCTTTCTCCCGGGGTCTTTTCCTGGAATCGCTGCTGTCATCA GAGCTTGAGTGACTGCCGGACATTCTGTTAACAACAACCTCTAATAGTAATGCTAAGTAAATGTTTAGTTTTTTGACATC ACGTAAAGTTTAATTTAAGGAGCTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_25: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148433385203AI067236EST208910Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148583385218AI067251EST208925Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148803385240AI067273EST208948Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150113385371AI067404EST209086Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150323385392AI067425EST209107Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153223385682AI067715EST209398Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153663385726AI067759EST209443Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154083385768AI067801EST209485Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155453385905AI067938EST209626Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156313385991AI068024EST209713Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:24:31 on Thu 23 Nov 117.