CShisMan2_2501


Sequence

>CShisMan2_2501 (2 EST) Length=165 CATTCAGATGAAGGACAATTTGGATCGTTAATAAACTGGTGAATAAATAAAAGGGAAGCAGATACCAAAGAGAGCAAATC AGCTTACAATAAGTAAATACATAAATGTATATTAATGAGGAAAACCACAAAACATAATCATGTATGTCAACTTTCCTCTN TATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_2501: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344399972800L46932SCMRAP019C2/C2 adult worm mini-library
4236211139722N25374EST000491S. mansoni cDNA


Date: 23:40:28 on Sat 18 Nov 117.