CShisMan2_2502


Sequence

>CShisMan2_2502 (2 EST) Length=162 ATAGTGTATCTTTTGTATCATGATTATCGAGGTATCGTAGGTTATCATATCTCCCGAAACGGTTCTCCGATCTTATCATC AGTCCCATTCTATCTAACCCGCAACCCAGCCCAGCCGATGGCCNGGACAACGCCATCGAAGAAACGTTATTCAACAAAGT TG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2502: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452573056755AA917182SMTBCEA000371SKSchistosoma Lambda Zap II cercariae
16891383116507AA952801SMTBCEA000378SKSchistosoma Lambda Zap II cercariae


Date: 2:5:38 on Wed 22 Nov 117.