CShisMan2_251


Sequence

>CShisMan2_251 (61 EST) Length=1521 GGGTGACATGGCTGCTCGTGCATTTAAAAAGTTCGCCCCTCTTTATGACCGAGTTCTGGTCCAACGTTTTGAGGCTGAAA CCATAAGTAAAGGTGGGATCATGATACCAGAGAAAGCTAAAGGCAAGGTTCTTGAAGCAACTGTGGTTGCACATGGTCCT GGATCGAGAAATGAAAAAGGTGAAGTTGTCCCTGTGTGTGTCAATGTTGGTGACAAAGTTTTCCTTCCTGAGTACGGTGG TACTAAAGTCGTACTGGACGAAAATGAGTATTTCCAAAACCGCGAAACTGACATTTTGGCCAAATTCGAAAATTGACCGG TGTTTTAGATCTAGTCCCCACACCTTTGTACACTGATTAATCAAATACCATAGTTTTTCATCTGTAATAAATCTTTTCGC ATATTGAAAAAAAACATGTAAAACTTAAAAACATGCCATGCAACTGCATTACCGCACGAGTAAATATAAATTTATAGTTT GGTGGATAACGTACCTTTTGTATCATGATTCATTGAGGTATTATAGGTTATTCTATTTCCCGAAAGGTTCTCGATTTTAT ATAGTTCATTCTGTTAATTATAGTTAGTTGGTGAGGTTGGATAAGTTACTAAGTAAGTATAATTAGAGAAACTATGTAGG TAGTGATAAATTATTCGTGTGATCTGATATCTGGTTAGTGACTTTATTTATCGAACTTAGGGAATAGCTGAGTGTGTTGG TTATTTAGGACAGAGATATTGTAATTATTATGTGATAGGGTCTGAGATTAAGATTGTCTTAGGTTAGTAAAGTTATTTAC ATAGCTTAGAAGATTGATTAATAAAAATCTTGTTGGTTAAGAGAGGTCATTTAGTAAAATTAGATATATAATGATGGTGG AATAAGTAGGTTAGATTATTGATTGTTTCTTTTTTCAGTATTGCACTCAACTGTTTATTAAAAACATTGCTATTAGTTAA TTGTTTAATAGTAAGGCCTGCTCAGTGAAGAAGTTTGTTTAAATAGCCGCGATTATTGATCGTGCTAAGGTAGCATAATA TATAGTCTTTTAATTGTAGACTTGTGAATGGTTCAATGAGGTGTGATTAAGGTGATAGTCTATTATCTGAATTTAGTTTA GTGGTTAGGAACCCACTGTTACATTATTAGACGGAAAGACCCCAAGAGCTTTTTTTGTGTTAGATTTGTTTGGGGTAAAT GTAGATTATTCATTTATTTTTAGATCCTTCATGGATAAAAGGATAAAGTTACCTTGGGGATAACTGAGTAAAGGACAGGG AGAGGTCCTATTGATCTGTTTATTACTACCTCGATGTTGGCTTGTTGAACCTTTTCGGTGTAGAGGCTGGAAAAGGAAGT CTGTTCGACTTTTAAATCTTCATGAGTTGAGTTAAGACCGGTGTAAGCCAGGTTGGTTCTTATCTATAATTGGTTCTGAT TAGTACGAAAGGATTATTAGGATACAGTGTTTCTGTACGTATAGGAATAGGAAGTATACATAGGTAAAAAAACTCGAGGG G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_251: (61 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343540973944R95214SMNHADA001010SKSmAW
343544973948R95218SMNHADA001051SKSmAW
344870975926R95556SMNHADA007066SKSmAW
344944976000R95515SMNHADA018026SKSmAW
350235988866H49025EST000120S. mansoni cDNA
4189781126865N21695SMNHADA009037SKSmAW
4236431139744N25396EST000092S. mansoni cDNA
8577841832544AA218451MAAD0106.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578381832598AA218505MAAD0177.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578551832615AA218522MAAD0210.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
9100811906146AA269049MA1MA049.AA3S. mansoni adult Lambda Zap
9102181906283AA269215MA1MR038.AA3S. mansoni adult Lambda Zap
11529322245767AA508327MAAD0411.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11587122252889AA514124MA2AS030.AASS. mansoni adult Lambda Zap
12100792330368AA559672MC180921.NA3TBRI-Saber-cercaria-A
12101102330399AA559703MC031048.NA3TBRI-Saber-cercaria-A
15130292854309AA791354SMTBADA000846SKSchistosoma Lambda Zap II
15234042870806AA801598SMTBADA000927SKSchistosoma Lambda Zap II
15469472897568AA825090SMTBCEA000007SKSchistosoma Lambda Zap II cercariae
15900262956650AA864171SMTBCEA000034SKSchistosoma Lambda Zap II cercariae
16099752992124AA883013SMTBCEA000041SKSchistosoma Lambda Zap II cercariae
16452083056541AA917147SMTBCEA000096SKSchistosoma Lambda Zap II
16716193098706AA938807SMTBADA000222SKSchistosoma Lambda Zap II
16891153116484AA952778SMTBCEA000009SKSchistosoma Lambda Zap II cercariae
16891853116554AA952848SMTBCEA000518SKSchistosoma Lambda Zap II cercariae
17368673189787AA999232MCCE3014.M1FSchistosoma mansoni, cercariae
17368753189795AA999240MCCE3022.M1FSchistosoma mansoni, cercariae
17370293189949AA999394MCCE3242.M1FSchistosoma mansoni, cercariae
17371913190111AA999556MCCE3481.M1FSchistosoma mansoni, cercariae
18146383384998AI067031EST208700Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148253385185AI067218EST208892Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149073385267AI067300EST208978Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149963385356AI067389EST209070Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149973385357AI067390EST209071Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151353385495AI067528EST209210Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151463385506AI067539EST209221Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151483385508AI067541EST209223Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151593385519AI067552EST209234Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152283385588AI067621EST209304Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153093385669AI067702EST209385Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153173385677AI067710EST209393Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153293385689AI067722EST209405Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153423385702AI067735EST209418Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153913385751AI067784EST209468Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154673385827AI067860EST209544Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154843385844AI067877EST209562Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155723385932AI067965EST209654Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155903385950AI067983EST209672Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156203385980AI068013EST209702Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156243385984AI068017EST209706Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157433386103AI068136EST209826Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157903386150AI068183EST209874Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158443386204AI068237EST209928Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158513386211AI068244EST209935Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158753386235AI068268EST209959Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159003386260AI068293EST209984Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159623386322AI068355EST210047Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159643386324AI068357EST210049Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694803509881AI110911MF003B10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694903509891AI110921MF003A12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695473509948AI110978MF002E02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 22:53:21 on Wed 22 Nov 117.