CShisMan2_253


Sequence

>CShisMan2_253 (4 EST) Length=715 TAAAATATTCAATGTTGATGGGATACTTTTACAAAATGTAATCAAATAATTGAATACTAGTAAAAATGTGATTTTTGAGT GTAGCTGTACTCAAAAAAGCAGAGGAATCCATATAGTTCTAAAATACTGGTATTCATCTATCCACATCATACAGATTTCT GAAACCAATTTATGAGTCATTTCGGTAGGGTCTATCGCTGTCTAGANTTTTTCTTTTTACCAGATTGTGATGGGTTACTG AAACCTGAAAAACTCTTGCCAATTTGGGAGAACTGATTTCCTGGGAAACTATTGGACACGAAATTAGGAGAAGGCTGGTT GTAGTGTCCTGAGATTTGGTTGACTGGAGGTAGATTGGGAGGAACTCCTGAATCATTTTCATTCTGTAAATTTAAAGATG AAACTGATGTGACTGAAGACCTCGAGAAAAGGCGATCGGAATCTCGGAACTTTCGAGCGCGTTTGTCTCCAACATTCCTG GAAAATTCTCGTGCCGAATTCGCACGAGCCAAAGAGCTCGAGCTGGACATCAAATATCTGTCCCAGCCCTTGATGATGTT CCCATAAGGAGCCGTGTCATCCAGATAGCTACCTTCAAATAGATATATCTGACGCTCTAATGCCCCCAGTGTTTCTGTCA AGCTCTTTCGTTGCCGTANGAGGTCAAAAAGTTCTGATTTGATATCTAAAACATTGGATTTGTGGTTTATTTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_253: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785962804092AA756922MF4MA164.AF3S. mansoni female adult Lambda Zap
17533383228013AI014181MEEG0304.M1RSchistosoma mansoni, egg stage
17533463228021AI014189MEEG0316.M1RSchistosoma mansoni, egg stage
17533473228022AI014190MEEG0317.M1RSchistosoma mansoni, egg stage


Date: 19:8:58 on Wed 22 Nov 117.