CShisMan2_2539


Sequence

>CShisMan2_2539 (3 EST) Length=172 TAATTTTTGGTGACAAGTTTTTTAGAAGATTTGTTTGTNTCATACACTTATTTTAGTNTTAGTTTGTAGTGAAGACTTAT TGTGACTTAATAGATGGGATTATTAATGATTTGTTTTGTTTCTTTTGGTACCTGGATTTATATCTACAAATAACTGATCA ACCGTCACTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2539: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344422972823L46955SCMRAP042C2/tcz2 adult worm mini-library
344485972886L47018SCMRAP1053303/TCZ2 adult worm mini-library
344771974627L47030SCMRAP1173303/TCZ2 adult worm mini-library


Date: 23:7:5 on Mon 20 Nov 117.