CShisMan2_2543


Sequence

>CShisMan2_2543 (2 EST) Length=152 TCTATTATCTGAATTTAGTTTAGTGGTTAGGAACCCACTGTTACATTATTAGACGGAGGAAAGACCCCAAGAGCTTTTTT TGTGTTAGATTTGTTTGGGGTAAATGTAGATTATTCATTTATTTTAGATCCTTCATGATTTTGATAAGTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_2543: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364711644607AA098637SMTBADAMS0639SKS. mansoni cDNA
16890963116465AA952759SMTBADA000639SKSchistosoma Lambda Zap II


Date: 1:19:35 on Mon 20 Nov 117.