CShisMan2_255


Sequence

>CShisMan2_255 (3 EST) Length=646 GGCAACAATTTATATTANTCCCGAAAAATGATAAATGTCCAAGATTTGGAGCAAGAGAATCCTAACTTTAAAAAAAACAG CAAATAGTATTCTTACCACAACTAACATCACATTTTACAGCTCATCGTGGTCACCAGATGGCTCGTCCGATGCTTTTGCA TCGTCTGGAAGCTCTTTTCGTTCTTTTGTTTCTTCAGCCTCCTCTTTGTCATCTTTTGCACTTGACTGTTCTTTAGCAAC TTCAGCATCGTATCGTTTTCCCCAAAGTCGCTCCCCCTCTTCCTTAGCGAAATCCGGACCTGTCAGTAATTAAAACGTTG TCCAAAGATTGACCCTGAATCCGACTTGCCACAGATCCAAAGCCGACATAACCGATGTCATTCCAGGACATACAATTCGG GATCATGTTTGTATTCTGGATTGTCAATCTGTACAGGCTTCCATTCTCCTTTGTATTTTGGATTATCGATACGTCTAGGT GTCCATTCGCCTTTATATTCCGGATTGTCTTTTTGAGGAACGTTCCCACTCACCATCCATAGCATCATCCCAATCATCTG GCTTTTTGGCATCCATATCAGGTATTGTTTTGGGCTGATCCCAATTATCAGGTTTNCTTGTCATCCGGATCATCGATAAA TTGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_255: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5136871444940W06720SMEST0356Schistosoma mansoni, adult worm, Gloria Franco
5136881444941W06721SMEST0357Schistosoma mansoni, adult worm, Gloria Franco
7807971705392H98311SMNHADA016084T3SmAW


Date: 0:36:47 on Sat 25 Nov 117.