CShisMan2_2552


Sequence

>CShisMan2_2552 (2 EST) Length=158 CAATCATTTTTTCGCCTAAATTATTTGTTTCAACCATAATTCTTTAATTCAGTCATACTGATTTTTTCATCATGATCNAA GATCAACTCTGGAAAAAAATGCNATGTAAAAATGGATCCATTCAATTGAACAATGATTTAAAGTAAATTAGTTCTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2552: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102121906277AA269209MA1MR032.AA3S. mansoni adult Lambda Zap
9102491906713AA269246MA1NE001.AASS. mansoni adult Lambda Zap


Date: 23:45:14 on Sat 18 Nov 117.