CShisMan2_256


Sequence

>CShisMan2_256 (61 EST) Length=1148 CGGCACGAGATATAATTTATTAGTTTATTATGATTTAATATTATATGTTTTAGGAATGAGGGTTTTTATTCCGTTATGAT GTGTTATAGTAATGTGTTATCAGATATATGAGTCTTTTCAAGTAAGTATAATTATTCCAAGTGAATCTCGGTTATTGGAA TTTGTTTGGACCTTGGTTCCATCTTTTATAGTTTTAGTATTATGCTTTTTTAACTTGAAATATTTAGTTTATTATAGTTC GTTTTGTTTTTCTGATCCAGTTAAGGTGATAGGTCATCAGTGGTATTGATCTTATGAATTATCAAGGGGGGCAAAGTATG ATTCATTTATGACTGATTTGATAGGTGGTGTTAATAAGCCTTTACGATTATTAATGAAGGTGCCATATTCATTACTTGTA ACATCTAGAGATGTTATACATTCTTTTTCAGTTCCTGATTTATATATAAAGATGGATGCGGTTCCAGGTCGAATTAATTG TTTAGGGGTAATATTAAGTCGTTTAGGGGTATTTACAGGTTATTGTTCAGAGTTATGCGGTGTGGGTCATGCTTATATGC CTATAGTGGTTGAAGTTGTAATGAATAAAAAGATGTAAACAGTAGAAATTTTTATGATGTTAGTTTTATTATCTATAGTT TTATTCGGGTTTACTTTTAAAGGTAGGCCTTTGACTCGAGCAGTTTTATTGGTTTTGGTTTCTTTTATAGTAAGTCTTTG GATATTTAAGGTTTTTAGTTTTAGTTGATACTTTTTATTATTTGTTTTGGTTTATGTTGGTGGTATCTATGTTATATTAA TTTATGTAAGTATGGCGTTTCCTAAATTTAGATTATTTAGATTTAAACTGCGAGGTTGAGCAGGTTTCGTAGTTTTATTA TTTTTGTTACTTGGGGTGTGGAGAGATGTGAGCGTTATGGATGAAGGGTTGATGGAGAATAGATTTTATTTATGTGGAGT TTCTGAAGTTTTAATCTATCTGTTTTTATGTTTAGTGTTGATGATTAGTTTAGTATTTATAAATTTTATTGTTGGGTTTT CTACTAGTAGATATTTTCGTTAATCGCAATTAAAGCTCGCTTAGTATAAGGGGAGTATGGCAAATTGTAAATTTGTAGGT AGAGTTAGTCTAGTCGGGATGTATATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_256: (61 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39144514538T14371SMEST0032Schistosoma mansoni, adult worm, Gloria Franco
39272514666T14499SMEST0160Schistosoma mansoni, adult worm, Gloria Franco
39323514717T14550SMEST0211Schistosoma mansoni, adult worm, Gloria Franco
39324514718T14551SMEST0212Schistosoma mansoni, adult worm, Gloria Franco
39381514775T14608SMEST0269Schistosoma mansoni, adult worm, Gloria Franco
344874975930R95560SMNHADA007076SKSmAW
344901975957R95587SMNHADA00E036SKSmAW
345020981287R95627SMNHADA019036SKSmAW
345024981291R95631SMNHADA019051SKSmAW
345031981298R95638SMNHADA019080SKSmAW
4180711125960N20788SMNHADA008083SKSmAW
4191451127996N21863SMNHADA019004SKSmAW
4236261139727N25379EST000526S. mansoni cDNA
5858961377957U58078SMU58078Schistosoma mansoni adult worm Lambda ZAP II library
7641711685487AA125668MLLG0204.M1FSchistosoma mansoni, lung stage
7791351702794AA140570MEEG0235.M1FSchistosoma mansoni, egg stage
7824331713271AA143866MCCE0249.M1RSchistosoma mansoni, cercariae
8578191832579AA218486MAAD0152.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
9100571906122AA269090MA1MA025.AA3S. mansoni adult Lambda Zap
11528992245734AA508294MAAD0487.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12099102330199AA559503MC270434.NA3TBRI-Saber-cercaria-A
12101512330440AA559744MC140318.NA3TBRI-Saber-cercaria-A
12102092330498AA559802MC250468.NA3TBRI-Saber-cercaria-A
12102162330505AA559809MC250479.NA3TBRI-Saber-cercaria-A
12165332338782AA566150MA3AS038.AASS. mansoni adult Lambda Zap
12165492338798AA566166MA3MA134.AA3S. mansoni adult Lambda Zap
12165532338802AA566170MA3MA138.AA3S. mansoni adult Lambda Zap
16716203098707AA938808SMTBADA000223SKSchistosoma Lambda Zap II
16716213098708AA938809SMTBADA000231SKSchistosoma Lambda Zap II
16716303098717AA938818SMTBADA000262SKSchistosoma Lambda Zap II
17580653233244AI018908SMEST0548Schistosoma mansoni, adult worm, Gloria Franco
17580753233254AI018918SMEST0558Schistosoma mansoni, adult worm, Gloria Franco
17581103233289AI018953SMEST0593Schistosoma mansoni, adult worm, Gloria Franco
17581413233320AI018984SMEST0624Schistosoma mansoni, adult worm, Gloria Franco
17654333241840AI026226MEEG0463.M1FSchistosoma mansoni, egg stage
18145773384937AI066970EST208635Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146483385008AI067041EST208710Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146623385022AI067055EST208724Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147683385128AI067161EST208832Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147943385154AI067187EST208860Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148833385243AI067276EST208951Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150183385378AI067411EST209093Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150753385435AI067468EST209150Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151093385469AI067502EST209184Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151303385490AI067523EST209205Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152433385603AI067636EST209319Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152463385606AI067639EST209322Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153763385736AI067769EST209453Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153983385758AI067791EST209475Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154103385770AI067803EST209487Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154163385776AI067809EST209493Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154273385787AI067820EST209504Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155953385955AI067988EST209677Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156363385996AI068029EST209718Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156803386040AI068073EST209762Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157523386112AI068145EST209836Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158043386164AI068197EST209888Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158843386244AI068277EST209968Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159113386271AI068304EST209995Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694343509835AI111147MF003F10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695953509996AI111026MF001H10.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 10:0:14 on Fri 24 Nov 117.