CShisMan2_2567


Sequence

>CShisMan2_2567 (2 EST) Length=150 ACTTAATAAAATAAAAGCGAATAATAATATGTCTAGGTAGAGAAATTATTATTAGTGTGCTTTACAAAAATGCAAAAGAC ATCTATTATACACTGATGAATAACTCAACTGTTCATAATTTCACAGAATGTCTAGAATGCTTTTTGTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2567: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364641644600AA098630SMTBADAMS0629SKS. mansoni cDNA
16890903116459AA952867SMTBADA000629SKSchistosoma Lambda Zap II


Date: 12:36:41 on Fri 17 Nov 117.