CShisMan2_257


Sequence

>CShisMan2_257 (4 EST) Length=744 TGCGCGAGTCCGTGATACCGTGCATGCAAAAATCGGCTTCTGCATAGCAGACCCAGGACTAGATATTGTCGGCCAAAAAT GGCGTTAACTGAATCGAAATAGGGGGAATAGACTTTAACTTAAAAACCTTGGGTGAGTGTTCCGTCATATTAATATAGAT AACGAAAAATGTCTAATTAAAATATATCCGAGAAAAAAAAATTCGCGAAAAAAGTATGTCACAATATATAAAATTCAAAT AAAGAATAACAATGAATAATAATATTCCAAAATGGAACAGACTCACAGTATATTGACTTGGTGTACCAGATCACGTCGGT CTCACCAATGATGATGCAACGGATGTTCTAGTTTTACAACTAGTTACCAGTAGCACCTTCTAAATTTGATCGTTCCCAGT CAGATAGAAATCAGAAGTCAGACGAGAAGAGGCAGGAAAGATATATTTGATTCGTTACCAATATATCGAGGACCTTTTCT ATGAGCTGGCTAATGAAACGTAGGAGCTGTGTCCCACGCNGTGTTGAAANGTGATTTGGTGCGGATGCATGACCGAAAGC CTTCAGCTAAACAAGTCCACTTAAACAACGTGGTCAGCATCCAATGTCGAACACTTAATGAGCTATTGATTTTGGGGAAT TATTTACAGCTACAGATCACTCCCCCCCTAGTGAGGTAGTGATGCCCCTAAGACGTGCACCAGCCAGAAGTTTAAACCCA ACGAGTTTGTTCGCTNGTCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_257: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099652330254AA559558MC070562.NA3TBRI-Saber-cercaria-A
12101862330475AA559779MC210239.NA3TBRI-Saber-cercaria-A
17371693190089AA999534MCCE3450.M1FSchistosoma mansoni, cercariae
18147393385099AI067132EST208803Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:19:56 on Mon 20 Nov 117.