CShisMan2_2579


Sequence

>CShisMan2_2579 (2 EST) Length=160 GGTGTACCTGGCTGGTGGTATGCCAGGAGGCATGCATGAGGCAAGTGGTGCTGGTGGTGGAAGTGGTAAGGGACCAACCA TCGAGGAGGTCGACTAACCTATAATTGTTGTGATAAATTGTTTGGTACTTGAATAATGAATTTAGATTTCATTGGTAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2579: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344880975936R95566SMNHADA008006SKSmAW
3879611065975H85661EST000343S. mansoni cDNA


Date: 4:32:37 on Sat 25 Nov 117.