CShisMan2_258


Sequence

>CShisMan2_258 (2 EST) Length=575 AAAATATGNCTAGGANATGGTTGNGGCATTTTTCCCTCCGGGNNCCNCCGACCCATAGTTTCCAATATNATTGACGTGTG CGGAACGGTTGAATTAAAGTGAANATAGCAAGTTGGACCCAGGGGCNAATGACTTATAGNCCAAGTGTCTGGAACCCCAC GTGATTCGTTGACAATAATGACATCGGTAATCTGTTTTGCTAAACAAGCTTCCNACCAATTCTTATTCAAGTAGTTACCC CGACCTAATTNTGGCAGCATTTGGAATGAGAAAACGTAATTCTTTAGCAAATTCTTTTAGTCTTGAGCTAGGAGAACGTG ATGTAGTGATCAACAACGCGCGGATCTTCAGTTCCAGCCCAGAGATACTCATCATCTTGATTAGTAGCAACTCCTTCACC GCCATCATCACTCCAGTCTAATTCTTCATTTAACTGTAAAGCACCTTCTTGAATTTCTTTAGGTAGCATTTTCCCTTCAG CTAAGGCAGCTTTTAACATCTTTTTCTTCTTTTCGTTTTCAGCATCTCGAACTTCAATTGATCCTCGTGCCGAACCTGCA GNCCTCGGTTAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_258: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190031126890N21720SMNHADA00E019SKSmAW
4192241128075N21942SMNHADA020054SKSmAW


Date: 22:5:5 on Fri 17 Nov 117.