CShisMan2_2584


Sequence

>CShisMan2_2584 (2 EST) Length=146 CGGTTCTACCAATCACTGTGCGCATTTGTGAAGTTCCGCCTGAAAATGCTCCTCTATCTGTTGTTAAATCACAATCCTCT TTCATTTCTGAAAACTAGTTGTTTGAGTTATACTCATGCTACTTTCCGAAATGAAAATATATCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2584: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344468972869L47001SCMRAP088G1/G2 adult worm mini-library
344470972871L47003SCMRAP090G1/G2 adult worm mini-library


Date: 6:39:40 on Sat 25 Nov 117.